Top » Catalog » I2 » Y5596

$18.00

Y5596
[Y5596]

Y5596
hg38 Position: ChrY:19858767..19858767
Ancestral: A
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: I2a1b2a1a (not listed)
Comments: Below S17250
Forward Primer: Y5596vl_F TTCTTCAATTGTCCTTATGCATTC
Reverse Primer: Y5596vl_R GGAAATTTCAAAAGGGAGGATG
Reviews

Customers who bought this product also purchased
BY106777
BY106777
A13911
A13911
CTS595
CTS595
M223
M223
M253
M253
A21222
A21222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies