Top » Catalog » I2 » S16196

$18.00

S16196
[S16196]

S16196
hg38 Position: ChrY:12488450..12488450
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a2a1b2a1b
Comments: Below CTS1977> Y4946 > Y7153 > Y7829.
Forward Primer: S16196_F AGGTGTCTGCAATCTCCTGTG
Reverse Primer: S16196_R AATGGGGACACTGGTCTTGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies