Top » Catalog » I2 » Y3548

$18.00

Y3548
[Y3548]

Y3548
hg38 Position: ChrY:12744908..12744908
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below or equivalent to S17250
Forward Primer: Y3548_F GTTTAAGGCACTCAGATGAAAGAAG
Reverse Primer: Y3548_R GCTTATTCCTGTAAACTAACCAGCC
Reviews

Customers who bought this product also purchased
Y43331
Y43331
Y56203
Y56203
FGC30452
FGC30452
Y16473
Y16473
A7358
A7358
A811
A811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY47211
1 x GG148
$36.00
Haplogroup Info
Other products
Currencies