Top » Catalog » I2 » A11115

$18.00

A11115
[A11115]

A11115
hg38 Position: ChrY:7782040..7782040
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of L161
Forward Primer: A11115_F CTTGGATGCAGGCGAGAG
Reverse Primer: A11115_R GGGTGATTTTGGGACGATTC
Reviews

Customers who bought this product also purchased
Y12075
Y12075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies