Top » Catalog » I2 » PF6328

$18.00

PF6328
[PF6328]

PF6328
hg38 Position: ChrY:19635358..19635358
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2c1a2a1a1
Comments: Extracted from genome study of Sardinian samples; also observed in several other haplogroups
Forward Primer: PF6328_F TGATTCTAACTCACTGCTTATTATTGG
Reverse Primer: PF6328_R ACCACACCTCATGAAAGTAAGC
Reviews

Customers who bought this product also purchased
L862
L862
M267
M267
Z1865
Z1865
L860
L860
L858
L858
Z18297
Z18297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18712
1 x S8171
$36.00
Haplogroup Info
Other products
Currencies