Top » Catalog » I2 » PF6328

$18.00

PF6328
[PF6328]

PF6328
hg38 Position: ChrY:19635358..19635358
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2c1a2a1a1
Comments: Extracted from genome study of Sardinian samples; also observed in several other haplogroups
Forward Primer: PF6328_F TGATTCTAACTCACTGCTTATTATTGG
Reverse Primer: PF6328_R ACCACACCTCATGAAAGTAAGC
Reviews

Customers who bought this product also purchased
L860
L860
L858
L858
Z18297
Z18297
Z1853
Z1853
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z18323
Z18323
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies