Top » Catalog » I2 » PH908

$18.00

PH908
[PH908]

PH908
hg38 Position: ChrY:11986358..11986358
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
Y134603
Y134603
Y126296
Y126296
Y151633
Y151633
Y99608
Y99608
Y81557
Y81557
PH1012
PH1012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies