Top » Catalog » I2 » BY3807

$18.00

BY3807
[BY3807]

BY3807
hg38 Position: ChrY:8495350..8495350
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: I2 (not listed)
Comments: .
Forward Primer: BY3807_F ATGTTGTATAAAGTTTTCAAATGTTGC
Reverse Primer: BY3807_R GAGCCCACGACAAAGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies