Top » Catalog » I2 » PF6950

$18.00

PF6950
[PF6950]

PF6950
hg38 Position: ChrY:14472976..14472976
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF6950_F CAGCAACAATCTCAGACAGCAG
Reverse Primer: PF6950_R GGATAGAAAACTATGACTCTAAGGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7190
1 x A7729
$36.00
Haplogroup Info
Other products
Currencies