Top » Catalog » I2 » BY3809

$18.00

BY3809
[BY3809]

BY3809
hg38 Position: ChrY:15504187..15504187
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below Y4751
Forward Primer: BY3809_F CCCAGTATCAGTTATTTCTTATACCAGC
Reverse Primer: BY3809_R GGCCTGGGTGTCTGTCAC
Reviews

Customers who bought this product also purchased
BY3811
BY3811
BY3810
BY3810
BY3610
BY3610
BY3812
BY3812
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7180
$18.00
Haplogroup Info
Other products
Currencies