Top » Catalog » I2 » BY3812

$18.00

BY3812
[BY3812]

BY3812
hg38 Position: ChrY:21600626..21600626
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: I2a2a1a1a1a1a (not listed)
Comments: Below Y4751 > Y21729
Forward Primer: BY3812_F GGAAAATGGTACAGGCAGAATG
Reverse Primer: BY3812_R CACTGCTTCACCTTGGACTTC
Reviews

Customers who bought this product also purchased
BY3610
BY3610
BY3811
BY3811
BY3810
BY3810
BY3809
BY3809
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies