Top » Catalog » I2 » FGC17393

$18.00

FGC17393
[FGC17393]

FGC17393
hg38 Position: ChrY:19202904..19202904
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I2a2a1b2a2a2b1 (not listed)
Comments: Below S8104 > FGC21175.
Forward Primer: FGC17393_F ATGAGGTTTTGCCATTTTGG
Reverse Primer: FGC17393_R AGGAGACAGGGAGGCAAATG
Reviews

Customers who bought this product also purchased
DYS589
DYS589
DNA Sample Kit
DNA Sample Kit
Y21996
Y21996
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies