Top » Catalog » I2 » M223

$18.00

M223
[M223]

M223
hg38 Position: ChrY:19555421..19555421
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: I2a2a
Comments: A8.05e
Forward Primer: M223_F TGGCTCATGTTGCTTGAGTTC
Reverse Primer: M223_R ACTGATTCAGTAAATCTCCTAACTTTGC
Reviews

Customers who bought this product also purchased
M304
M304
P38
P38
CTS595
CTS595
M253
M253
Y39696
Y39696
BY54878
BY54878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14879
$18.00
Haplogroup Info
Other products
Currencies