Top » Catalog » I2 » M223

$18.00

M223
[M223]

M223
hg38 Position: ChrY:19555421..19555421
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: I2a2a
Comments: A8.05e
Forward Primer: M223_F TGGCTCATGTTGCTTGAGTTC
Reverse Primer: M223_R ACTGATTCAGTAAATCTCCTAACTTTGC
Reviews

Customers who bought this product also purchased
A10033
A10033
A417
A417
Y4252
Y4252
A7111
A7111
M26
M26
A15050
A15050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies