Top » Catalog » I2 » BY3098

$18.00

BY3098
[BY3098]

BY3098
hg38 Position: ChrY:12028302..12028302
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: I2a2a1b2a2a1a1a1a* (not listed)
Comments: Downstream Y17535
Forward Primer: BY3098_F GCCTCAGGATTAAGTAGTTAAAGATTG
Reverse Primer: BY3098_R ATAATTTCTTATCATTTACCTCCCACTTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies