Top » Catalog » I2 » A13174

$18.00

A13174
[A13174]

A13174
hg38 Position: ChrY:7957102..7957102
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below PF4189 parallel to PF4188
Forward Primer: A13174_F TTCATCTTTTGACAAAAGGACTACAG
Reverse Primer: A13174_R CTATTTGCCACTTTATCAGGAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY47211
1 x GG148
$36.00
Haplogroup Info
Other products
Currencies