Top » Catalog » I2 » A13176

$18.00

A13176
[A13176]

A13176
hg38 Position: ChrY:13764814..13764814
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below PF4189 parallel to PF4188
Forward Primer: A13176_F TTTCCATATGATGCATATGATAAGATC
Reverse Primer: A13176_R AAGACCACATGTTTTAATGAAGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS10093
1 x A16521
$36.00
Haplogroup Info
Other products
Currencies