Top » Catalog » I2 » A13627

$18.00

A13627
[A13627]

A13627
hg38 Position: ChrY:8362647..8362647
Ancestral: G
Derived: C
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: I2a (not listed)
Comments: Below Y21971 > A11749
Forward Primer: A13627_F GCTGCATAATAATCGGTTGTG
Reverse Primer: A13627_R ACCTGGACCCAGCCAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY3610
1 x A19475
1 x Y4200
$54.00
Haplogroup Info
Other products
Currencies