Top » Catalog » I2 » A13630

$18.00

A13630
[A13630]

A13630
hg38 Position: ChrY:20520027..20520027
Ancestral: G
Derived: C
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: I2a
Comments: Below Y21971
Forward Primer: A13630_F TTGCAAATATGGGATTCCTTG
Reverse Primer: A13630_R GGAGATGTCAAAGGGCTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies