Top » Catalog » I2 » A13664

$18.00

A13664
[A13664]

A13664
hg38 Position: ChrY:14204274..14204274
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A13664_F TTGGATTGCAATGAGTTTGG
Reverse Primer: A13664_R TCCCTAGGTCCTTTGAGCTG
Reviews

Customers who bought this product also purchased
A11374
A11374
Y11772
Y11772
A14359
A14359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19381
$18.00
Haplogroup Info
Other products
Currencies