Top » Catalog » I2 » A13665

$18.00

A13665
[A13665]

A13665
hg38 Position: ChrY:17433331..17433331
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A13665_F TGGGGACAGGTTGAGAGAAC
Reverse Primer: A13665_R AGCAAAGTCGTTGCCAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies