Top » Catalog » I2 » A13913

$18.00

A13913
[A13913]

A13913
hg38 Position: ChrY:20858228..20858228
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2a
Comments: Below PH908
Forward Primer: A13913_F ACTCCCCAGCGAGGAGAAC
Reverse Primer: A13913_R AACAGAATCTGGCTCTAGCATTG
Reviews

Customers who bought this product also purchased
A13907
A13907
A13912
A13912
A13911
A13911
A13910
A13910
A13909
A13909
A13908
A13908
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies