Top » Catalog » I2 » PH1012

$18.00

PH1012
[PH1012]

PH1012
hg38 Position: ChrY:12093538..12093538
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a
Comments: Below PH908
Forward Primer: PH1012_F GGATCTGAGCCATGAGTATGC
Reverse Primer: PH1012_R TCAAGGTTCATCCACACTGC
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
FT14649
FT14649
A20333
A20333
PH3310
PH3310
Y32084
Y32084
PH908
PH908
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies