Top » Catalog » I2 » FGC14463

$18.00

FGC14463
[FGC14463]

FGC14463
hg38 Position: ChrY:16974830..16974830
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > FGC7126 > Y3734 > FGC14457
Forward Primer: FGC14463_F TCATTCCTCCTTCATAGCCTTATC
Reverse Primer: FGC14463_R GCCTGCTTACCTTCAAGTATACG
Reviews

Customers who bought this product also purchased
L161.1
L161.1
A7729
A7729
I2a-M423 Panel
I2a-M423 Panel
FGC7156
FGC7156
A544
A544
Y3734
Y3734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies