Top » Catalog » I2 » FGC14463

$18.00

FGC14463
[FGC14463]

FGC14463
hg38 Position: ChrY:16974830..16974830
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > FGC7126 > Y3734 > FGC14457
Forward Primer: FGC14463_F TCATTCCTCCTTCATAGCCTTATC
Reverse Primer: FGC14463_R GCCTGCTTACCTTCAAGTATACG
Reviews

Customers who bought this product also purchased
A544
A544
Y3734
Y3734
FGC7126
FGC7126
FGC14457
FGC14457
L161.1
L161.1
A7729
A7729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4459
1 x FGC31135
1 x FGC31376
$54.00
Haplogroup Info
Other products
Currencies