Top » Catalog » I2 » A14301

$18.00

A14301
[A14301]

A14301
hg38 Position: ChrY:7079547..7079547
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below PH908
Forward Primer: A14301_F TAGGACTTCAGTGCCCTTGC
Reverse Primer: A14301_R TCCATTAATGCATCCCACTG
Reviews

Customers who bought this product also purchased
A5914
A5914
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY6785
$18.00
Haplogroup Info
Other products
Currencies