Top » Catalog » I2 » A14798

$18.00

A14798
[A14798]

A14798
hg38 Position: ChrY:7689965..7689965
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017) Big Y
ISOGG Haplogroup: I2a
Comments: Below S17250 > A5875
Forward Primer: A14798_F AGCCATGTGCCCTAAATGAC
Reverse Primer: A14798_R ATGAGAGGCCCTTTGGAATG
Reviews

Customers who bought this product also purchased
A5875
A5875
L161.1
L161.1
A5874
A5874
I2a-M423 Panel
I2a-M423 Panel
A815
A815
Y5596
Y5596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies