Top » Catalog » I2 » PF4088

$18.00

PF4088
[PF4088]

PF4088
hg38 Position: ChrY:8813086..8813086
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2a1a1a1a
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4088_F TCACTCAATTTTGCAGCTTG
Reverse Primer: PF4088_R GGAGGAAAACCGCATTCTG
Reviews

Customers who bought this product also purchased
BY130413
BY130413
Z27030
Z27030
Y23411
Y23411
Z27034
Z27034
Y24017
Y24017
A19455
A19455
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies