Top » Catalog » I2 » A14877

$18.00

A14877
[A14877]

A14877
hg38 Position: ChrY:2796053..2796053
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A14877_F GCCAGGATGGTCTCAATCTC
Reverse Primer: A14877_R CGGCCCATAATCTTCTGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies