Top » Catalog » I2 » A14879

$18.00

A14879
[A14879]

A14879
hg38 Position: ChrY:12016228..12016228
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A14879_F GGGCATGAAGAAAGATCTGC
Reverse Primer: A14879_R GGGTTAAATGGCAGTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS644
1 x A18002
$27.95
Haplogroup Info
Other products
Currencies