Top » Catalog » I2 » A14893

$18.00

A14893
[A14893]

A14893
hg38 Position: ChrY:13827756..13827756
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233 > A8462
Forward Primer: A14893_F GCCAATTGGAGGAGAAGTTG
Reverse Primer: A14893_R GTCCCATTCTTCAGCCTCTG
Reviews

Customers who bought this product also purchased
F25958
F25958
CTS595
CTS595
A8462
A8462
I2a-CTS595 Panel
I2a-CTS595 Panel
L1287
L1287
Y4252
Y4252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies