Top » Catalog » I2 » A14893

$18.00

A14893
[A14893]

A14893
hg38 Position: ChrY:13827756..13827756
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below L233 > A8462
Forward Primer: A14893_F GCCAATTGGAGGAGAAGTTG
Reverse Primer: A14893_R GTCCCATTCTTCAGCCTCTG
Reviews

Customers who bought this product also purchased
Y4252
Y4252
L160
L160
A16520
A16520
M26
M26
F25958
F25958
CTS595
CTS595
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies