Top » Catalog » I2 » A15051

$18.00

A15051
[A15051]

A15051
hg38 Position: ChrY:14085050..14085050
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below Y4252
Forward Primer: A15051_F TGGCTCCACTATCCAAGGAG
Reverse Primer: A15051_R CTTCTCAGTGGTGGGAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF3647
1 x R1b-A689 Panel
1 x A6106
$125.00
Haplogroup Info
Other products
Currencies