Top » Catalog » I2 » A15076

$18.00

A15076
[A15076]

A15076
hg38 Position: ChrY:19683050..19683050
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Below L233 > Y4252
Forward Primer: A15076_F ATCATCCTGAAGGGGAGGAG
Reverse Primer: A15076_R ATCCCCCAGAAATCACCTTC
Reviews

Customers who bought this product also purchased
A19385
A19385
A19485
A19485
L160
L160
A19384
A19384
Y33761
Y33761
Y4200
Y4200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20215
$18.00
Haplogroup Info
Other products
Currencies