Top » Catalog » I2 » CTS1758

$18.00

CTS1758
[CTS1758]

CTS1758
hg38 Position: ChrY:11930216..11930216
Ancestral: G
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a1a1a (not listed)
Comments: Below PF4088. Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS1758v2_F CATGTCTTCTAGTGGCAATCAAAG
Reverse Primer: CTS1758v2_R CCCCCTTCCATATGAACAGTC
Reviews

Customers who bought this product also purchased
BY130413
BY130413
Z27030
Z27030
Z27034
Z27034
A19455
A19455
Y84185
Y84185
A17271
A17271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4459
1 x FGC31135
1 x FGC31376
1 x Y3679
$72.00
Haplogroup Info
Other products
Currencies