Top » Catalog » I2 » PF6947

$18.00

PF6947
[PF6947]

PF6947
hg38 Position: ChrY:21704444..21704444
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2a1a1 (not listed)
Comments: Below M26 > CTS12005. Extracted from genome study of Sardinian samples
Forward Primer: PF6947_F TCAACTCCTCTCTCTACTGTGC
Reverse Primer: PF6947_R CTTAAAATAGCACTAAGTGGCCGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC52628
1 x M310.2
1 x BY1434
1 x A21223
1 x BY113517
1 x CTS1616
1 x FGC5674
1 x FGC681
$144.00
Haplogroup Info
Other products
Currencies