Top » Catalog » I2 » FGC3634

$18.00

FGC3634
[FGC3634]

FGC3634
hg38 Position: ChrY:2905879..2905879
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FGC3634_F GAGCAGAGATCGAGCCACC
Reverse Primer: FGC3634_R CCGTCACCCAAGCAGTACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L147.3
1 x S295
$36.00
Haplogroup Info
Other products
Currencies