Top » Catalog » I2 » A16452

$18.00

A16452
[A16452]

A16452
hg38 Position: ChrY:21482731..21482731
Ancestral: G
Derived: A
Reference: John OGrady (2017)
ISOGG Haplogroup: I2
Comments: downstream of A1513 A1514
Forward Primer: A16452_F GTTCACCAAGGCAAGAAACC
Reverse Primer: A16452_R TGACACAAAGTTTCATTGTTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19301
1 x PF3892
1 x Y5751
1 x BY19896
1 x A17458
$90.00
Haplogroup Info
Other products
Currencies