Top » Catalog » I2 » A16522

$18.00

A16522
[A16522]

A16522
hg38 Position: ChrY:14362192..14362192
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a (not listed)
Comments: Below CTS595 > L233 > A8462 > A16520
Forward Primer: A16522_F AACCCTGGGAAGCATTTTG
Reverse Primer: A16522_R AAACATCTGTGGCAGGGAAC
Reviews

Customers who bought this product also purchased
A16520
A16520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x B60
1 x BY19910
1 x A22226
$54.00
Haplogroup Info
Other products
Currencies