Top » Catalog » I2 » A16524

$18.00

A16524
[A16524]

A16524
hg38 Position: ChrY:16571555..16571555
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A16524_F TGAACGTGAATGGTCCTCAG
Reverse Primer: A16524_R CCCACCTGGTTCTTACAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21520
1 x F2908
1 x A11213
$54.00
Haplogroup Info
Other products
Currencies