Top » Catalog » I2 » A16659

$18.00

A16659
[A16659]

A16659
hg38 Position: ChrY:14199406..14199406
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below CTS10936 >CTS10228
Forward Primer: A16659_F AAACCTCCTGCTCTCTGCTG
Reverse Primer: A16659_R AAGCAGCCTTTTCCTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies