Top » Catalog » I2 » A811

$18.00

A811
[A811]

A811
hg38 Position: ChrY:15952760..15952760
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a2a~
Comments: Below Y4882
Forward Primer: A811_F TAGCTGGGACTGTGGGTATG
Reverse Primer: A811_R GCTAAACAGTGCTGCCATTG
Reviews

Customers who bought this product also purchased
Y152112
Y152112
Y144303
Y144303
A22312
A22312
Y15928
Y15928
Y12075
Y12075
A13909
A13909
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies