Top » Catalog » I2 » A811

$18.00

A811
[A811]

A811
hg38 Position: ChrY:15952760..15952760
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a2a~
Comments: Below Y4882
Forward Primer: A811_F TAGCTGGGACTGTGGGTATG
Reverse Primer: A811_R GCTAAACAGTGCTGCCATTG
Reviews

Customers who bought this product also purchased
A12505
A12505
A7318
A7318
Z16971
Z16971
Y3548
Y3548
PH908
PH908
Y5596
Y5596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies