Top » Catalog » I2 » A811

$18.00

A811
[A811]

A811
hg38 Position: ChrY:15952760..15952760
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a2a~
Comments: Below Y4882
Forward Primer: A811_F TAGCTGGGACTGTGGGTATG
Reverse Primer: A811_R GCTAAACAGTGCTGCCATTG
Reviews

Customers who bought this product also purchased
PLE07
PLE07
M89
M89
A10230
A10230
M9
M9
S2679
S2679
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies