Top » Catalog » I2 » A813

$18.00

A813
[A813]

A813
hg38 Position: ChrY:12674988..12674988
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Equivalent to PF4135 and Y11765
Forward Primer: A813_F CCGAAAACAATTTTTAAAGACATC
Reverse Primer: A813_R TCTTGCCAAATCTTGTAAGGTG
Reviews

Customers who bought this product also purchased
A1150
A1150
I2a-M423 Panel
I2a-M423 Panel
L1498
L1498
S2639
S2639
FGC7126
FGC7126
CTS10228
CTS10228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies