Top » Catalog » I2 » A813

$18.00

A813
[A813]

A813
hg38 Position: ChrY:12674988..12674988
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Equivalent to PF4135 and Y11765
Forward Primer: A813_F CCGAAAACAATTTTTAAAGACATC
Reverse Primer: A813_R TCTTGCCAAATCTTGTAAGGTG
Reviews

Customers who bought this product also purchased
L1498
L1498
S2639
S2639
FGC7126
FGC7126
CTS10228
CTS10228
L161.1
L161.1
A1150
A1150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies