Top » Catalog » I2 » A814

$18.00

A814
[A814]

A814
hg38 Position: ChrY:19498589..19498589
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Downstream PF4135
Forward Primer: A814_F AACAAGGCCATTTCAGAAGG
Reverse Primer: A814_R AAGCCCACAGGATGTAAACC
Reviews

Customers who bought this product also purchased
CTS10228
CTS10228
A1514
A1514
Y45481
Y45481
L161.1
L161.1
Y14605
Y14605
A2293
A2293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies