Top » Catalog » I2 » A814

$18.00

A814
[A814]

A814
hg38 Position: ChrY:19498589..19498589
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Downstream PF4135
Forward Primer: A814_F AACAAGGCCATTTCAGAAGG
Reverse Primer: A814_R AAGCCCACAGGATGTAAACC
Reviews

Customers who bought this product also purchased
Y14605
Y14605
A2293
A2293
I2a-M423 Panel
I2a-M423 Panel
Y3734
Y3734
FGC8393
FGC8393
S2742
S2742
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies