Top » Catalog » I2 » A814

$18.00

A814
[A814]

A814
hg38 Position: ChrY:19498589..19498589
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1b~
Comments: Downstream PF4135
Forward Primer: A814_F AACAAGGCCATTTCAGAAGG
Reverse Primer: A814_R AAGCCCACAGGATGTAAACC
Reviews

Customers who bought this product also purchased
S2742
S2742
CTS4122
CTS4122
FGC7126
FGC7126
A2329
A2329
CTS10228
CTS10228
A1514
A1514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7719
1 x A11214
$36.00
Haplogroup Info
Other products
Currencies