Top » Catalog » I2 » A812

$18.00

A812
[A812]

A812
hg38 Position: ChrY:7086498..7086498
Ancestral: C
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2 (not listed)
Comments: Equivalent or downstream PF4135
Forward Primer: A812_F CCAGCATCATGTTGGCAAG
Reverse Primer: A812_R GTTCAAGAGATTCTCCTGCCTCT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies