Top » Catalog » I2 » A815

$18.00

A815
[A815]

A815
hg38 Position: ChrY:14791801..14791801
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b2a1a1a~
Comments: Below S17250. approx. Z16971
Forward Primer: A815_F CTACCAAATTCTCTAACCCACAGAC
Reverse Primer: A815_R ATCTACCAAACAGGACCGAGAC
Reviews

Customers who bought this product also purchased
A14798
A14798
A5875
A5875
PH908
PH908
Y4460
Y4460
A5874
A5874
A356
A356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies