Top » Catalog » I2 » A17065

$18.00

A17065
[A17065]

A17065
hg38 Position: ChrY:16800157..16800157
Ancestral: A
Derived: T
Reference: David Nicolson (2017)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: A17065_F TCAGATTTTTGGGGTTCACAG
Reverse Primer: A17065_R TCAGCCAACTCCCTACTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22968
$18.00
Haplogroup Info
Other products
Currencies