Top » Catalog » I2 » A17067

$18.00

A17067
[A17067]

A17067
hg38 Position: ChrY:7482561..7482561
Ancestral: C
Derived: A
Reference: David Nicolson (2017)
ISOGG Haplogroup: I2
Comments: Below BY3099
Forward Primer: A17067_F TCCTGGGGTCTGAGAAAATG
Reverse Primer: A17067_R CCCTGCTTCAAATGATCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS4413
1 x S17221
1 x GG250
$54.00
Haplogroup Info
Other products
Currencies